View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2312_high_49 (Length: 307)
Name: NF2312_high_49
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2312_high_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 16 - 289
Target Start/End: Original strand, 33127144 - 33127418
Alignment:
| Q |
16 |
attgaattaaggtaaagtggtggtagtttctttttgaggggaaagcatggcgtgtataaacactttcacctccattggttgttcctgaaaagagctaaac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33127144 |
attgaattaaggtaaagtggtggtagtttctttttgaggggaaagcatggtgtgtataaacactttcacctccattggttgttcctgaaaagagctaaac |
33127243 |
T |
 |
| Q |
116 |
caccaaaactacatatatcaataagtaagtttggattacaagcataaactttgaaccatgttccacaccaaagacatgcataaaggagtctaag-nnnnn |
214 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33127244 |
caccaaaactacatatatcaataagcaagtttggattacaagcataaattttgaaccatgttccacaccaaagacatgcataaaggagtctaagaaaaag |
33127343 |
T |
 |
| Q |
215 |
nnnnnnnnnnngttcaatttaattatttaatttaggttaacatgtctacaagtgagatcacgaaaatggaagaag |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33127344 |
aaagaaaaaaagttcaatttaattatttaatttaggttaacatgtctacaagtgagatcacgaaaatggaagaag |
33127418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University