View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2312_high_61 (Length: 274)
Name: NF2312_high_61
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2312_high_61 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 7e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 143 - 268
Target Start/End: Complemental strand, 9979117 - 9978990
Alignment:
| Q |
143 |
gattgtgataactcataatagaactct--atgtgatgatgataatacagataagaggtgtacgtttagaggatacggtagatgtgtccgcattgaagcca |
240 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9979117 |
gattgtgataactcataatagaactctttatgtgatgatgataatacagataagaggtgtacgtttaaaggatacggtagatgtgtccgcattgaagcca |
9979018 |
T |
|
| Q |
241 |
tgcctcctcactttagttgaaggttcat |
268 |
Q |
| |
|
|| ||||||||||||||||||||||||| |
|
|
| T |
9979017 |
tgtctcctcactttagttgaaggttcat |
9978990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 9979291 - 9979247
Alignment:
| Q |
1 |
atacataagaaccttggatttaaaatcttgttctagatgaactta |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9979291 |
atacataagaaccttggatttaaaatcttgttctagatgaactta |
9979247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University