View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2312_high_62 (Length: 273)
Name: NF2312_high_62
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2312_high_62 |
 |  |
|
| [»] chr4 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 241; Significance: 1e-133; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 273
Target Start/End: Original strand, 38103178 - 38103450
Alignment:
| Q |
1 |
aaactggttcaatatcattgtctttgatggtcctcaccacccttatgggagtgatctgttagattcatgtgaaaagaagcaccatatcatgttactagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38103178 |
aaactggttcaatatcattgtctttgctggtcctcaccacccttatgggagtgatctgttagattcatgtgaaaagaagcaccatatcatgttactagtt |
38103277 |
T |
 |
| Q |
101 |
attggaaaaatctcatccattaannnnnnnnattgtcatatctaatggttttgcaacgtaatcattctgaattaagtaccactttttcttttggtaagaa |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38103278 |
attggaaaaatctcatccattaattttttttattgtcatatctaatggttttgcaacgtaatcattctaaattaagtaccactttttcttttggtaagaa |
38103377 |
T |
 |
| Q |
201 |
attaggcaccactcttaaagatttatttagagataaactaatcgaattacacatagtttaattagagcttttc |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38103378 |
attaggcaccactcttaaagatttatttagagataaactaatcgaattacacatagtttaattagagcttttc |
38103450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 299260 - 299178
Alignment:
| Q |
1 |
aaactggttcaatatcattgtctttgatggtcctcaccacccttatgggagtgatctgttagattcatgtgaaaagaagcacc |
83 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
299260 |
aaactggttcaatatcattgtctttgctggtcctcacctcccttatgggagtgatctgttagattcatgtgaaatgaagcacc |
299178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 220 - 273
Target Start/End: Complemental strand, 298952 - 298900
Alignment:
| Q |
220 |
gatttatttagagataaactaatcgaattacacatagtttaattagagcttttc |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
298952 |
gatttatttagagataaactaatcgaatta-acatagtttaattagagcttttc |
298900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 170 - 221
Target Start/End: Complemental strand, 299045 - 298994
Alignment:
| Q |
170 |
aattaagtaccactttttcttttggtaagaaattaggcaccactcttaaaga |
221 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
299045 |
aattaagtaccactttttcttttgacaagaaattaggcaccactcttaaaga |
298994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University