View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2312_high_64 (Length: 271)
Name: NF2312_high_64
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2312_high_64 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 29020704 - 29020451
Alignment:
| Q |
1 |
tatgactcaggaagattttggtgtattttgtgttgtctctaatttatgctacttttgtttcctttcatctttcatagactcattttggaggtctttcata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
29020704 |
tatgactcaggaagattttggtgtattttgtgttgtctctaatttatgctacttttgtttcctttcatctttgatagactcattttggaggtctttcata |
29020605 |
T |
|
| Q |
101 |
atatgtttcttgaactgaattatgaaatttgcgacttcattgacacgagggcagcaaggattctatcagaggtttctagtttaaaatccattacaagttt |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | |
|
|
| T |
29020604 |
atatgtttcatgaactgaattatgaaatttgcgacttcattgacacgagggcagcaaggattctatcagcggtttctagtttaaaatccattacaagt-t |
29020506 |
T |
|
| Q |
201 |
tttgagagattatcatttttcaatttgtactaatgtaacctcgtggactgagagt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29020505 |
tttgagagattatcatttttcaatttgtactaatgtaacctcgtggactgagagt |
29020451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University