View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2312_high_73 (Length: 252)
Name: NF2312_high_73
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2312_high_73 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 46 - 234
Target Start/End: Original strand, 42281743 - 42281931
Alignment:
| Q |
46 |
atttctattggtgacaaaagtgttcttataatcctatgattgtctaaaaagggcaaatgtcaacatgtgctctaagggtagggctggtcatcagtcaatt |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42281743 |
atttctattggtgacaaaagtgttcttataatcctatgattgtctaaaaagggcaaatgtcaacatgtgctctaagggtagggctggtcatcagtcaatt |
42281842 |
T |
 |
| Q |
146 |
tcggtcgaaaatcggggccaaaacctcgatctgcactaatccatcgttggaactcctaggctcaattccagtctcggtttagtcggttt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42281843 |
tcggtcgaaaatcggggccaaaacctcgatctgcgctaacccatcgttggaactcctaggctcaattccagtctcggtttagttggttt |
42281931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University