View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2312_high_74 (Length: 252)
Name: NF2312_high_74
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2312_high_74 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 15673141 - 15673362
Alignment:
| Q |
18 |
aaactgatcatttttagcaaaatatgggagcaggagtacaatttcgagggtccatataccatcgtaattaagggactactcgagctggattggcccagca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
15673141 |
aaactgatcatttttagcaaaatatgggggcaggagtacaatttcgagggtccatatatcatcgtaattaagtgactactcgagctggattggcccagca |
15673240 |
T |
 |
| Q |
118 |
aaaaccaatgatgataggctattttgtcttggaaaattgctccttttcactttcaaaatgtctttcagacacttcaaaaatacaaaaacgtcttcggcgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
15673241 |
aaaaccaatgatgataggctattttgtcttggaaaattgctctttttcactttcaaaatgtctttgagacacttcaaaaatacaaaaacgtcttcggcgg |
15673340 |
T |
 |
| Q |
218 |
tagttaaccgtcattgttcctt |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
15673341 |
tagttaaccgtcattgttcctt |
15673362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University