View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2312_high_84 (Length: 247)
Name: NF2312_high_84
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2312_high_84 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 12 - 228
Target Start/End: Original strand, 51348349 - 51348557
Alignment:
| Q |
12 |
gggggaaaagtacacttttgcttttttaatactaatattaaaacatatttgagatatgacacagccaaacatatactttggagataatgttgattaagtt |
111 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||| |||||||| ||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
51348349 |
gggggaaaagtgcacttttacttttttaatactaatattgaaacatat---------gacacagccaaacatatactttgaaaataatgttgattaagtt |
51348439 |
T |
|
| Q |
112 |
ggaggaaccgatttctggggggaagagtagtagtaggagttaaaatgggaggatgtaaatgaat-aaatgatgatgattgagagaattggggccgtatgt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
51348440 |
ggaggaaccgatttctggggggaagagtagtagtaggagttaaaatgggaggatgtaaatgaataaaatgatgatgattgagagaattggggccgtatgt |
51348539 |
T |
|
| Q |
211 |
atgtatgtgggacttggt |
228 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
51348540 |
atgtatgtgggacttggt |
51348557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University