View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2312_high_96 (Length: 238)
Name: NF2312_high_96
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2312_high_96 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 26903906 - 26904128
Alignment:
| Q |
1 |
tggttgatagattttttcttccacgcatannnnnnnaggggaatgaatattatat---ttttattaattctttatgagtttaattgataggtaatataaa |
97 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26903906 |
tggttgatagattttttcttccacgcatatttttttaggggaatgaatattatatattttttattaattctttatgagtttaattgataggtaatataaa |
26904005 |
T |
 |
| Q |
98 |
ataatattacatattgtccaatgatattctatcacatactatttgtggagactcttatatatcaaatacggtgtctttgatttttaaatgtacttttgaa |
197 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
26904006 |
ataatattacatattgtccaatgatattttatcacataatatttgtggagactcttatatat--aatacggtgtctttgatttttaaatgtacttttgaa |
26904103 |
T |
 |
| Q |
198 |
atgtatgtaaattatcatatataaa |
222 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
26904104 |
atgtatgtaaattatcatatataaa |
26904128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University