View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2312_high_97 (Length: 237)
Name: NF2312_high_97
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2312_high_97 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 40428410 - 40428470
Alignment:
| Q |
1 |
attgagagatgtttctttgattcgcaaaatggtaagtattgaaaacatgacaaaacaataa |
61 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
40428410 |
attgagagatgtttctttgattcgcaaatcgggaagtattgaaaacatgacaaaacaataa |
40428470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University