View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2312_low_100 (Length: 244)
Name: NF2312_low_100
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2312_low_100 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 103 - 227
Target Start/End: Complemental strand, 43565137 - 43565013
Alignment:
| Q |
103 |
atggctccaccaaattccacaacccttgatctcatcaaaaccgagtcattatttgatttatctgagggaaagtttaaggtgagaggtgttcctttgttcc |
202 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |||| |||| ||||||||| |
|
|
| T |
43565137 |
atggctccaccgaattccacaaaccttgatctcatcaaaactgagtctttatttgatttatctgagggaaagtttaaggttagagatgtttctttgttcc |
43565038 |
T |
|
| Q |
203 |
atgatgttcctgagaatgtttcttt |
227 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
43565037 |
atgatgttcctgagaatgtttcttt |
43565013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 44954838 - 44954872
Alignment:
| Q |
1 |
ccccatcatagagtaaggtttttcacttcccttca |
35 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
44954838 |
ccccatcatagagtaaggattttcacttcccttca |
44954872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 115 - 228
Target Start/End: Original strand, 43973477 - 43973590
Alignment:
| Q |
115 |
aattccacaacccttgatctcatcaaaaccgagtcattatttgatttatctgagggaaagtttaaggtgagaggtgttcctttgttccatgatgttcctg |
214 |
Q |
| |
|
||||||||| |||||||||| ||||||| ||||| |||||||||||||| ||||||| |||| |||| ||| |||||||||||||||||||||||| |
|
|
| T |
43973477 |
aattccacagcccttgatcttgtcaaaactgagtctttatttgatttatccgagggaacatttactgtgaaaggcgttcctttgttccatgatgttccta |
43973576 |
T |
|
| Q |
215 |
agaatgtttctttt |
228 |
Q |
| |
|
| |||||||||||| |
|
|
| T |
43973577 |
acaatgtttctttt |
43973590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 120 - 227
Target Start/End: Complemental strand, 36433075 - 36432968
Alignment:
| Q |
120 |
cacaacccttgatctcatcaaaaccgagtcattatttgatttatctgagggaaagtttaaggtgagaggtgttcctttgttccatgatgttcctgagaat |
219 |
Q |
| |
|
||||||||||||| | ||||||| |||||||| |||||||||| |||||||| || | || || |||||||||||||| |||||||||||||||||| |
|
|
| T |
36433075 |
cacaacccttgatattgtcaaaactgagtcattgcttgatttatccgagggaaaattcactgttaggggtgttcctttgtttcatgatgttcctgagaat |
36432976 |
T |
|
| Q |
220 |
gtttcttt |
227 |
Q |
| |
|
|||||||| |
|
|
| T |
36432975 |
gtttcttt |
36432968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 213
Target Start/End: Original strand, 8952102 - 8952134
Alignment:
| Q |
181 |
gtgagaggtgttcctttgttccatgatgttcct |
213 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
8952102 |
gtgaaaggtgttcctttgttccatgatgttcct |
8952134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University