View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2312_low_102 (Length: 239)
Name: NF2312_low_102
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2312_low_102 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 81 - 235
Target Start/End: Original strand, 24463688 - 24463842
Alignment:
| Q |
81 |
caaacattgaaatcttatccacgtgatcttgatctaataatcatcaatatgttaattgtgtcgatatgtaagatccttactacttccactaggctccggt |
180 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |||||||||||||||| |||||| |||||||| |
|
|
| T |
24463688 |
caaatattgaaatcttatccacgtgattttgatctaatgatcatcaatatgttaattgtgtcgatatataagatccttactactcccactaagctccggt |
24463787 |
T |
 |
| Q |
181 |
tcttttttataagaaatattggacaatttttaaatatattagatgttaagtttca |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24463788 |
tcttttttataagaaatattggacaatttttaaatatattagatgttaagtttca |
24463842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 233
Target Start/End: Original strand, 24725820 - 24725870
Alignment:
| Q |
183 |
ttttttataagaaatattggacaatttttaaatatattagatgttaagttt |
233 |
Q |
| |
|
|||||||||||||||||| ||||||| |||| ||||||||||||||||| |
|
|
| T |
24725820 |
ttttttataagaaatattaaccaattttcaaatgtattagatgttaagttt |
24725870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University