View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2312_low_111 (Length: 237)
Name: NF2312_low_111
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2312_low_111 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 37211720 - 37211942
Alignment:
| Q |
1 |
taattaatgttgttacttgttatgatataagatactcatgcattggcataaagtcaaattaccttttcaagtgatggtccttggtagaatgaacttattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37211720 |
taattaatgttgttacttgttatgatataagatactcatgcattggcataaagtcaaattacctttttaagtgatggtccttggtagaatgaacttattt |
37211819 |
T |
 |
| Q |
101 |
atgtcacagatgaatattattcccaataggcttgatatttgaattttgagttgttaatatgcatggtccagaaattactctaacatgttttggaggtttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37211820 |
atgtcacagatgaatattattcccaattggcttgatatttgaattttgagttgttaatatgcatggtccagaaattactctaacatgttttggaggtttc |
37211919 |
T |
 |
| Q |
201 |
atgttaaaattgcatgtgattaa |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37211920 |
atgttaaaattgcatgtgattaa |
37211942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University