View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2312_low_112 (Length: 236)
Name: NF2312_low_112
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2312_low_112 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 21 - 225
Target Start/End: Original strand, 26764241 - 26764445
Alignment:
| Q |
21 |
tcatagtgtcaatttctcaatcaaagcaagattatggttgtctattcaaaatcttcccatttattaacattctcattcaaactagtttatcaacatataa |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26764241 |
tcatagtgtcaatttctcaatcaaagcaagattatggttgtctattcaaaatcttcccatttattaacattctcattcaaactggtttatcaacatataa |
26764340 |
T |
|
| Q |
121 |
gcagattttattgaaaaaagagttcaaaaccacaatctagacctcaacatcnnnnnnntttaaatttgaaccgtctgcagttgaaaacactatgcattca |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
26764341 |
gcagattttattgaaaaaagagttcaaaaccacaatctagacctcaacatcaaaattttttaaatttggaccgtctgcagttgaaaatactatgcattca |
26764440 |
T |
|
| Q |
221 |
tctca |
225 |
Q |
| |
|
||||| |
|
|
| T |
26764441 |
tctca |
26764445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University