View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2312_low_116 (Length: 235)

Name: NF2312_low_116
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2312_low_116
NF2312_low_116
[»] chr8 (1 HSPs)
chr8 (1-220)||(26865773-26865992)


Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 26865992 - 26865773
Alignment:
1 atggcggttgaattctttgcaaatgcttatcaagaggatgataatgacccaatgtttgaaacaatggtgagaggagtcaaagctaagtttgatgaagata 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26865992 atggcggttgaattctttgcaaatgcttatcaagaggatgataatgacccaatgtttgaaacaatggtgagaggagtcaaagctaagtttgatgaagata 26865893  T
101 cgttaacaattgcttggcacaaaggctcctttaaggagaattagaaaagattaaggaggaactttgtgttgagaatacaccatggtcaaaataaaccaaa 200  Q
    | |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||    
26865892 cattaacaattgcttggcacaaaggctcctttaaggagaattagaaaagatttaggaggaactttgtgttgagaatacaccgtggtcaaaataaaccaaa 26865793  T
201 ggcttcctacctacataatt 220  Q
    ||||||||||||||| ||||    
26865792 ggcttcctacctacaaaatt 26865773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University