View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2312_low_119 (Length: 227)
Name: NF2312_low_119
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2312_low_119 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 107 - 215
Target Start/End: Complemental strand, 510397 - 510290
Alignment:
| Q |
107 |
cataagctagctagttgaagctcaacttgaatgaatgttcaaatagctattcttcttctctataatgcaatgtaatcctttatgcacgcaaaaacatctt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
510397 |
cataagctagctagttgaagctcaacttgaatgaatgttcaaatagctattcttcttctctataatgcaatgtaatcctttatgcacgc-aaaacatctt |
510299 |
T |
 |
| Q |
207 |
ctgtcttca |
215 |
Q |
| |
|
||||||||| |
|
|
| T |
510298 |
ctgtcttca |
510290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University