View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2312_low_126 (Length: 218)
Name: NF2312_low_126
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2312_low_126 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 22 - 72
Target Start/End: Original strand, 8131084 - 8131134
Alignment:
| Q |
22 |
gagggtgttcatggtccaacaggagatcgaagaggcacttggtgaagcaaa |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8131084 |
gagggtgttcatggtccaacaggagatcgaagaggcacttggtgaagcaaa |
8131134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 72 - 117
Target Start/End: Original strand, 8131185 - 8131230
Alignment:
| Q |
72 |
ataatgccttgattcgaagaggaagattgcttctacgatttggctc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8131185 |
ataatgccttgattcgaagaggaagattggttctacgatttggctc |
8131230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University