View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2312_low_127 (Length: 216)
Name: NF2312_low_127
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2312_low_127 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 16 - 200
Target Start/End: Complemental strand, 46809303 - 46809119
Alignment:
| Q |
16 |
gaaggataatgatcaactgttagaaatagaaaaactagtattggtgtaaactatttatatatgtggtgcatgtgaggaaaagtttagcattatatatatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46809303 |
gaaggataatgatcaactgttagaaatagaaaaactagtattggtgtaaactatttatatatgtggtgcatgtgaggaaaagtttagcattatatatatt |
46809204 |
T |
|
| Q |
116 |
acctgaaatttaccaggcctattaacaggtatgacgagatctactaccctaagatcctcatcattgtcttggttaactagataag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46809203 |
acctgaaatttaccaggcctattaacaggtatgacgagatctactaccctaagatcctcatcattgtcttggttaactagataag |
46809119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 30298170 - 30298105
Alignment:
| Q |
111 |
atattacctgaaatttaccaggcctattaacaggtatgacgagatctactaccctaagatcctcat |
176 |
Q |
| |
|
||||||||||||||||||| || || ||||| || ||| | ||||||| ||| ||||||||||||| |
|
|
| T |
30298170 |
atattacctgaaatttaccgggtctgttaacggggatggcaagatctaatactctaagatcctcat |
30298105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University