View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2312_low_128 (Length: 215)
Name: NF2312_low_128
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2312_low_128 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 27 - 203
Target Start/End: Original strand, 39165273 - 39165453
Alignment:
| Q |
27 |
tataagctctgactccccatatcttgatcatatcaagagcaatatttgata----attaaacaactctcttcggagtcactccatgcttccgaagatgag |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39165273 |
tataagctctgactccccatatcttgatcatatcaagagcaatatttgatagagaattaaacaactctcttcggagtcactccatgcatccgaagatgag |
39165372 |
T |
 |
| Q |
123 |
ggaacccacacaatcttataactgtccttccgtctcttattcaaatgacgatcacatgtgttcttaatcagtaagaataat |
203 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39165373 |
ggaacccacacaatcttataattgtccttccgtctcttattcaaatgatgatcacatgtgttcttaatcagtaagaataat |
39165453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University