View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2312_low_32 (Length: 385)
Name: NF2312_low_32
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2312_low_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 2e-59; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 203 - 369
Target Start/End: Original strand, 36489966 - 36490130
Alignment:
| Q |
203 |
gctaccttgttttcacagctgcagtaattatgattatgatatgcttggcaaagctactagtttttgacaggacaaagagggcatggaccaaaagacgaaa |
302 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36489966 |
gctaccttgttttcacaactgcagtaattatgattatgatatgcttgtcaaaggtactagtttttgacaggacaaagagggcatggaccaaaagacgaaa |
36490065 |
T |
|
| Q |
303 |
gnnnnnnnnnnngacaaaacagaagcagttttttcacgtgtccactgtcattccctccaaatttatg |
369 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36490066 |
g--aaaaaaaaagacaaaacagaagcagttttttcacgtgtccactgtcattccctccaaatttatg |
36490130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 26 - 87
Target Start/End: Original strand, 36489648 - 36489709
Alignment:
| Q |
26 |
ttaatttaaaggtgtatcatagaagttctttagttatactatttgaatagactctgatgttt |
87 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36489648 |
ttaatttgcaggtgtaccatagaagttctttagttatactatttgaatacactctgatgttt |
36489709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University