View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2312_low_38 (Length: 368)
Name: NF2312_low_38
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2312_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 31 - 349
Target Start/End: Complemental strand, 45301604 - 45301283
Alignment:
| Q |
31 |
aattactttgaacattgcaactaaatgcttacaacttatgcagaaataatacttattaaaaaatgatataataatttgtattaagatcttaaatatacta |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
45301604 |
aattactttgaacattgcaactaaatgcttacaacttatgcagaaataatacttattaaaaaatgaaataataatttgtattaagatcttaaacatacta |
45301505 |
T |
 |
| Q |
131 |
acatgatatgtaacnnnnnnnnn-tacaaacatgataccaacaaagtataatctggttcttcgaggattggttccaacatgttcttggagtgtgactttt |
229 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45301504 |
acatgatatgtaacaaaaaaaaaatacaaacatgataccaacaaagtataatctggttcttcgaggattggttccaacatgttcttggagtgtgactttt |
45301405 |
T |
 |
| Q |
230 |
acagcaatcgttggcatctaattcttggttggtggtgatttacactgctcaacctgacggtatcggt--tcacgcgcttcagtttggtggctcacatgtc |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45301404 |
acagcaatcgttggcatctaattcttggttggtggtgatttacactgctcaacctgacggtatcggttctcacgcgcttcagtttggtggctcacatgtc |
45301305 |
T |
 |
| Q |
328 |
ttcaggaaggaaattcgtggtt |
349 |
Q |
| |
|
|| ||||||||||| ||||||| |
|
|
| T |
45301304 |
ttaaggaaggaaatccgtggtt |
45301283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University