View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2312_low_48 (Length: 326)
Name: NF2312_low_48
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2312_low_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 4e-69; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 159 - 310
Target Start/End: Complemental strand, 22232044 - 22231888
Alignment:
| Q |
159 |
aagaacatcgcatattattattacaaaagatgaaaagaaaatctattttccaccaaa-----caaaaattcagattgaaggattcctgacaagccccctc |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22232044 |
aagaacatcgcatattattattacaaaagatgaaaagaaaatctattttccaccaaattaaacaaaaattcagattgaaggattcctgacaagccccctc |
22231945 |
T |
 |
| Q |
254 |
accactcagcagtgcacccatttacaacacattggtccttccaaacattgatgactt |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
22231944 |
accactcagcagtgcacccatttacaacacattggtcctcccaaacattgatgactt |
22231888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 11 - 107
Target Start/End: Complemental strand, 22232192 - 22232096
Alignment:
| Q |
11 |
atgaatatccgacaaacatagcaacatatacagttgctcatttaatatgtgagacaacttggaaaatgcagtgtggtttgtgttttggcagcaactg |
107 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22232192 |
atgaatatccgacaaacatagtaacatatacagttgctcatttaatatgtgagacaacttggaaaatgcagtgtggtttgtgttttggcagcaactg |
22232096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University