View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2312_low_49 (Length: 325)
Name: NF2312_low_49
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2312_low_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 286; Significance: 1e-160; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 11 - 308
Target Start/End: Complemental strand, 30869760 - 30869463
Alignment:
| Q |
11 |
gagcacagaaccctttcttgacgagtactacttgaccgatatggatgaaacactgagggaagctggttttgtgaacataaaatcaattcttaccgaccct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30869760 |
gagcacagaaccctttcttgacgagtactacttgaccgatatggatgaaacactgagggaagctggttttgtgaacataaaatcaattcttaccgaccct |
30869661 |
T |
 |
| Q |
111 |
aggcacgttactttaacagctactgtgcctcaatgaaacatcttgggattttgtttcctttaaaactttttggaatacacaaacaactttaagtttaatg |
210 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30869660 |
aggcacgtaactttaacggctactgtgcctcaatgaaacatcttgggattttgtttcctttaaaactttttggaatacacaaacaactttaagtttaatg |
30869561 |
T |
 |
| Q |
211 |
aaaggttttacttgttaggaagctttatttggttgttttttgctttgttctttggttagcttgaatggtgtatgatcaagaatagtagattaggaatg |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30869560 |
aaaggttttacttgttaggaagctttatttggttgttttttgctttgttctttggttagcttgaatggtgtatgatcaagaataatagattaggaatg |
30869463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 129 - 178
Target Start/End: Complemental strand, 30861128 - 30861080
Alignment:
| Q |
129 |
gctactgtgcctcaatgaaacatcttgggattttgtttcctttaaaactt |
178 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30861128 |
gctactgtgcctcaatgaaa-atcttgggattttgtttcctttaaaactt |
30861080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University