View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2312_low_66 (Length: 278)
Name: NF2312_low_66
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2312_low_66 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 11 - 263
Target Start/End: Complemental strand, 40752952 - 40752700
Alignment:
| Q |
11 |
cataggataatgtatctatttaagtacataaatagggcacaattgtcttgtgaagacaacaaaagtgacttgccatccacagccctaaaccaacccctct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40752952 |
cataggataatgtatctatttaagtacataaatagggcacaattgtcttgtgaagacaacaaaagtgacttgccatccacagccctaaaccaacccctct |
40752853 |
T |
 |
| Q |
111 |
cacttcactttcttcaagacttctctctcccatgcttgatgctcaagacttttgttgcaccataattctataaacaatatctacagcaccctcatctacc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40752852 |
cacttcactttcttcaagacttctctctcccatgcttgatgctcaagacttttgttgcaccataattctataaacaatatctacagcaccctcatctacc |
40752753 |
T |
 |
| Q |
211 |
atattccacacatggatgattcttcttctgcagctgaagacaccaagagttgt |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40752752 |
atattccacacatggatgattcttcttctgcagctgaagacaccaagagttgt |
40752700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University