View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2312_low_68 (Length: 274)
Name: NF2312_low_68
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2312_low_68 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 6e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 91 - 262
Target Start/End: Complemental strand, 43403588 - 43403417
Alignment:
| Q |
91 |
attatatattgatcataattctctgcaatatcaaagatcacgacgatgcaagactcaattggtattcctacatgcttttcaccagcagataagctaacag |
190 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
43403588 |
attatatattgattgtaattctctgcaatatcaaagatcacgacgatgcaagactcaattggtattcctacatgcttttcaccagcagataagctaaccg |
43403489 |
T |
|
| Q |
191 |
atgatcatggaggcggtgtgacacgttacggtcagagtgtatacatgtcagtatacagaacaaaggtagctg |
262 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43403488 |
atgatcatggaggcggtgtgacacgttccggtcagagtgtatacatgtcagtatacagaacaaaggtagctg |
43403417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 13 - 68
Target Start/End: Complemental strand, 43403676 - 43403621
Alignment:
| Q |
13 |
tatctttacctaatttttaaaaaattaggctgttttcgcaacctgagtcgctccat |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43403676 |
tatctttacctaatttttaaaaaattaggctgttttcgcaacctgagtcgctccat |
43403621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University