View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2312_low_71 (Length: 272)
Name: NF2312_low_71
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2312_low_71 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 261
Target Start/End: Original strand, 39365313 - 39365582
Alignment:
| Q |
1 |
ctcagccctaagtccagtttttcgaaccctttttagaaccttcttctgatcagcaaaaccattcaccgtcaccttttgcaacttcatgtctatttcaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39365313 |
ctcagccctaagtccagtttttcgaaccctttttagaaccttcttctgatcagcaaaaccattcaccgtcaccttttgcaacttcatgtctatttcaatg |
39365412 |
T |
 |
| Q |
101 |
tcatccacacctttaaatacatacaaaaaatcatatgatcactattaccttatgcttggaaggaagatgaaaatgtacaaaat---------aaggtacc |
191 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39365413 |
tcatccacacctttaaataaatacaaaaaatcatatgatcactattaccttatgcttggaaggaagatgaaaatgtacaaaataagcaaacgaaggtacc |
39365512 |
T |
 |
| Q |
192 |
tttcattttctgaagtgcagttttcactttgttttcacatccagggcaatccatgtgcaccctcatctct |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39365513 |
tttcattttctgaagtgcagttttcactttgttttcacatccagggcaatccatgtgcaccctcatctct |
39365582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University