View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2312_low_78 (Length: 255)
Name: NF2312_low_78
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2312_low_78 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 248
Target Start/End: Complemental strand, 10558499 - 10558269
Alignment:
| Q |
18 |
ataattattaattgcataggcttacacagaaaatgaaaaactgtttatgcatttctatgatctatccatcccacatatgctgattccggtaattacaaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10558499 |
ataattattaattgcataggcttacacagaaaatgaaaaactgtttatgcatttctatgatctatccatcccacatatgctgattccggtaattacaaag |
10558400 |
T |
|
| Q |
118 |
ggttcaaaattgggagagaggaagtagtcctaaaccaaatattagatacataagtatgaacactaatgtcataataaatcggatgtgtaatgtaagacct |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10558399 |
ggttcaaaattgggagagaggaagtagtcctaaaccaaatattagatacataagtatgaacactaatgtcataataaattggatgtgtaatgtaagacct |
10558300 |
T |
|
| Q |
218 |
ttcatttcaaggggaaaccttcttcatctca |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10558299 |
ttcatttcaaggggaaaccttcttcatctca |
10558269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University