View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2312_low_83 (Length: 252)

Name: NF2312_low_83
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2312_low_83
NF2312_low_83
[»] chr5 (1 HSPs)
chr5 (18-239)||(15673141-15673362)


Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 15673141 - 15673362
Alignment:
18 aaactgatcatttttagcaaaatatgggagcaggagtacaatttcgagggtccatataccatcgtaattaagggactactcgagctggattggcccagca 117  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||    
15673141 aaactgatcatttttagcaaaatatgggggcaggagtacaatttcgagggtccatatatcatcgtaattaagtgactactcgagctggattggcccagca 15673240  T
118 aaaaccaatgatgataggctattttgtcttggaaaattgctccttttcactttcaaaatgtctttcagacacttcaaaaatacaaaaacgtcttcggcgg 217  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
15673241 aaaaccaatgatgataggctattttgtcttggaaaattgctctttttcactttcaaaatgtctttgagacacttcaaaaatacaaaaacgtcttcggcgg 15673340  T
218 tagttaaccgtcattgttcctt 239  Q
    ||||||||||||||||||||||    
15673341 tagttaaccgtcattgttcctt 15673362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University