View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2312_low_86 (Length: 250)
Name: NF2312_low_86
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2312_low_86 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 9 - 241
Target Start/End: Original strand, 2659911 - 2660158
Alignment:
| Q |
9 |
agcagagaattataccctttatatttgtcaagctgcttaatctcttggaattttctcg---------------ttttcgttagactatgaaactcggata |
93 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| ||||||||||||||| ||||||| |
|
|
| T |
2659911 |
agcagagaattataccctttatatctgtcaagctgcttaatctcttggaattttctctagagttgatctaatttttccgttagactatgaaattcggata |
2660010 |
T |
|
| Q |
94 |
cttcaaaattgaagacggatctatttcaaataatgatactcgtgcgttccttagaagtatcgtaagtaacgtaattatttattttactttgtaaaaaata |
193 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2660011 |
cttcaaaattgaagacggatctgtttcaaataatgatactcgtgcgttccttagaagtatcgtaagtaacgtaattatttattttattttgtaaaaaata |
2660110 |
T |
|
| Q |
194 |
atttactagatacatatatgatacttctaggtactcgtggatacatat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2660111 |
atttactagatacatatatgatacttctaggtactcgtggatacatat |
2660158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University