View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2312_low_93 (Length: 247)

Name: NF2312_low_93
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2312_low_93
NF2312_low_93
[»] chr3 (1 HSPs)
chr3 (12-228)||(51348349-51348557)


Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 12 - 228
Target Start/End: Original strand, 51348349 - 51348557
Alignment:
12 gggggaaaagtacacttttgcttttttaatactaatattaaaacatatttgagatatgacacagccaaacatatactttggagataatgttgattaagtt 111  Q
    ||||||||||| ||||||| ||||||||||||||||||| ||||||||         ||||||||||||||||||||||| | |||||||||||||||||    
51348349 gggggaaaagtgcacttttacttttttaatactaatattgaaacatat---------gacacagccaaacatatactttgaaaataatgttgattaagtt 51348439  T
112 ggaggaaccgatttctggggggaagagtagtagtaggagttaaaatgggaggatgtaaatgaat-aaatgatgatgattgagagaattggggccgtatgt 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
51348440 ggaggaaccgatttctggggggaagagtagtagtaggagttaaaatgggaggatgtaaatgaataaaatgatgatgattgagagaattggggccgtatgt 51348539  T
211 atgtatgtgggacttggt 228  Q
    ||||||||||||||||||    
51348540 atgtatgtgggacttggt 51348557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University