View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2312_low_94 (Length: 247)
Name: NF2312_low_94
Description: NF2312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2312_low_94 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 42393557 - 42393313
Alignment:
| Q |
1 |
cagtaatgaaagaaacccttcgtttgcacccatcacttccacttctaatgcctcattgcccaagtgaaaccaccaacgtaggaggctacacaattccaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42393557 |
cagtaatgaaagaaacccttcgtttgcacccatcacttccacttctaatgtctcattgcccaagtgaaaccaccaacgtaggaggctacacaattccaaa |
42393458 |
T |
 |
| Q |
101 |
ggggtcttgtgtgtttgtgaacgtttgggctattcatagagacccttccatttgggagaaaccgttagaatttgatccgacaaggttcttggatggtaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42393457 |
ggggtcttgtgtgtttgtgaacgtttgggctattcatagagacccttccatttgggagaaaccgctagaatttgatccgacaaggttcttggatggtaaa |
42393358 |
T |
 |
| Q |
201 |
tgggattataaagggaatgacttcaattatttcccctttgcttct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42393357 |
tgggattataaagggaatgacttcaattatttcccctttggttct |
42393313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 42377005 - 42376766
Alignment:
| Q |
1 |
cagtaatgaaagaaacccttcgtttgcacccatcacttccacttctaatgcctcattgcccaagtgaaaccaccaacgtaggaggctacacaattccaaa |
100 |
Q |
| |
|
|||| ||||||||||| |||||||| ||||| ||||||||||| || | ||||| ||||||||||||||||||||| | |||||||||||||||||| | |
|
|
| T |
42377005 |
cagtgatgaaagaaactcttcgtttacaccctgcacttccacttttagtccctcactgcccaagtgaaaccaccaacattggaggctacacaattccaga |
42376906 |
T |
 |
| Q |
101 |
ggggtcttgtgtgtttgtgaacgtttgggctattcatagagacccttccatttgggagaaaccgttagaatttgatccgacaaggttcttggatggtaaa |
200 |
Q |
| |
|
||| ||| |||| ||| | |||||||||||||||||||||||||||| |||||||||| || ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42376905 |
gggatctcgtgtctttatcaacgtttgggctattcatagagacccttatgtttgggagaacccactagaatttgatcctacaaggttcttggatggtaaa |
42376806 |
T |
 |
| Q |
201 |
tgggattataaagggaatgacttcaattatttcccctttg |
240 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| |||| |
|
|
| T |
42376805 |
tgggattatagtgggaatgacttcaactatttcccttttg |
42376766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 42387354 - 42387228
Alignment:
| Q |
1 |
cagtaatgaaagaaacccttcgtttgcacccatcacttccacttctaatgcctcattgcccaagtgaaaccaccaacgtaggaggctacacaattccaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| || | ||||| ||||||||||||||||||||| | |||||||||||||||||| | |
|
|
| T |
42387354 |
cagtaatgaaagaaacccttcgtttgcacccaacacttccacttttagtccctcactgcccaagtgaaaccaccaacattggaggctacacaattccaga |
42387255 |
T |
 |
| Q |
101 |
ggggtcttgtgtgtttgtgaacgtttg |
127 |
Q |
| |
|
||| ||| |||| ||| | |||||||| |
|
|
| T |
42387254 |
gggatctcgtgtctttatcaacgtttg |
42387228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 182 - 240
Target Start/End: Complemental strand, 42387220 - 42387162
Alignment:
| Q |
182 |
aaggttcttggatggtaaatgggattataaagggaatgacttcaattatttcccctttg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| |||||||| |||| |
|
|
| T |
42387220 |
aaggttcttggatggtaaatgggattatagtgggaatgacttcaactatttcccttttg |
42387162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University