View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2314_high_23 (Length: 222)
Name: NF2314_high_23
Description: NF2314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2314_high_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 11359339 - 11359125
Alignment:
| Q |
1 |
gacaccacgacatgcctttgattcgtgcatgtttggattgatggtgaggttgacataatcattggtgaaacaatgtatattttgcaaaagctactgctct |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11359339 |
gacaccacgacatgcctttgattcgtacatgtttggattgatggtgaggttgacataatcattggtgaaacaatgtatattttgcaaaagctactactct |
11359240 |
T |
|
| Q |
101 |
ttggagcttaccaaattgtggtgccactcttattttgcgaagttcactgtcaatccaaacatataccaagtgttgttgcaacataagttggtgctaagca |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11359239 |
ttggagcttaccaaattgcggtgccactcttattttgcaaagttcactgtcaatccaaacatataccaagtgttgttgcaacataagttggtgctaagca |
11359140 |
T |
|
| Q |
201 |
ttgaatatattcttc |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
11359139 |
ttgaatatattcttc |
11359125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 61
Target Start/End: Original strand, 18639723 - 18639759
Alignment:
| Q |
25 |
gtgcatgtttggattgatggtgaggttgacataatca |
61 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
18639723 |
gtgcatgtctggattgatggtgagattgacataatca |
18639759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 61
Target Start/End: Complemental strand, 1837649 - 1837613
Alignment:
| Q |
25 |
gtgcatgtttggattgatggtgaggttgacataatca |
61 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
1837649 |
gtgcatgtctggattgatggtgagattgacataatca |
1837613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University