View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2314_low_11 (Length: 394)
Name: NF2314_low_11
Description: NF2314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2314_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 1e-94; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 19 - 194
Target Start/End: Original strand, 28818607 - 28818782
Alignment:
| Q |
19 |
acctaggactagtacatgagcatgccctctttcacaagggaagaaattaagttaggttccacatcatggacccctcctatatatgccttctttaatgaca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28818607 |
acctaggactagtacatgagcatgccctctttcacaagggaagaaattaagttaggttccacatcatggacccctcctatatatgccttctttaatgaca |
28818706 |
T |
|
| Q |
119 |
tccatattctatgctttgttttgtactatcccaatatttggagcaggtccacccaacccccaactgaaattttgga |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28818707 |
tccatattctatgctttgttttgtactatcccaatatttggagcaggtccacccaacccccaactgaaattttgga |
28818782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 248 - 382
Target Start/End: Original strand, 28818838 - 28818972
Alignment:
| Q |
248 |
gacaacttatgtgtgacacacatttctaacccttttgcacaaagtctaacacgtctacacattcttgaacaagataaaataaaagaaagcaacatggcat |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28818838 |
gacaacttatgtgtgacacacatttctaacccttttgcacaaagtctaacacgtctacacattcttgaacaagataaaataaaagaaagcaacatggcat |
28818937 |
T |
|
| Q |
348 |
gggccaagataattagaaaggtctcctatcacctt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
28818938 |
gggccaagataattagaaaggtctcctatcacctt |
28818972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University