View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2315_high_5 (Length: 250)
Name: NF2315_high_5
Description: NF2315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2315_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 180 - 248
Target Start/End: Complemental strand, 23614032 - 23613964
Alignment:
| Q |
180 |
ctttactacatataaagaataagggctgtctttttcttttcctattatagttgtgctattttgttgtgt |
248 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23614032 |
ctttactacatataaagaatacgggctgtctttttcttttccgattatagttgtgctattttgttgtgt |
23613964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 15 - 71
Target Start/End: Complemental strand, 23614198 - 23614142
Alignment:
| Q |
15 |
tatgtattatttttatatatagattagcgtggacacttcgtacacatccgttctctc |
71 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||||| ||||||||||| |
|
|
| T |
23614198 |
tatgtattatttttatatatagattagcatggacactccgtacacgtccgttctctc |
23614142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University