View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2315_high_6 (Length: 236)
Name: NF2315_high_6
Description: NF2315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2315_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 26806476 - 26806260
Alignment:
| Q |
1 |
ttggaattttttaaaagtatttattggaaaactttgtgaatttataaaatacagggaccatctccaaaatttatactaacattcaattatattagaactt |
100 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26806476 |
ttgggattttttagaagtatttattggaaaactttgtaaatttataaaatacagggaccatctccaaaatttatactaacattcaattatactagaactt |
26806377 |
T |
 |
| Q |
101 |
aata-ttttttcgtcaannnnnnnctttctaatcgtgttattatcggacattaaatattaccctctcttagtcataatttaatttgaaccttgatgcgtc |
199 |
Q |
| |
|
| || |||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| ||| |
|
|
| T |
26806376 |
attatttttttcgtcaatttttttctttctaatcgtgttattatcggacattaaatattaccc-ctcttagtca-----gaatttgaaccttgatgtgtc |
26806283 |
T |
 |
| Q |
200 |
gtattgttggatctactccttct |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
26806282 |
atattgttggatctactccttct |
26806260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University