View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2315_high_7 (Length: 230)
Name: NF2315_high_7
Description: NF2315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2315_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 5 - 213
Target Start/End: Original strand, 26806473 - 26806679
Alignment:
| Q |
5 |
ccaaattggtccttatatannnnnnncaaaattaacaaacctagattatcaaattttgtaaattagtccctattttgagaatggagaattttattactct |
104 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26806473 |
ccaaattggtccttatatatttttttcaaaattaacaaacctagattatcaaattttgtaaattagtccctattttgagaatcgagaattttattactct |
26806572 |
T |
 |
| Q |
105 |
attcaaatgnnnnnnnnnnnnnnnntgaatggaattgaagctttcgaattgcttaaaattataatttctcttaatttcccattatcctatccaacaaact |
204 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26806573 |
attcaaatg-aaaaaaaattaaaaatgaat-gaattgaagctttcgaattgcttaaaattataatttctcttaatttcccattatcctatccaacaaact |
26806670 |
T |
 |
| Q |
205 |
ctaaaaatg |
213 |
Q |
| |
|
||||||||| |
|
|
| T |
26806671 |
ctaaaaatg |
26806679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University