View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2316_high_10 (Length: 230)
Name: NF2316_high_10
Description: NF2316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2316_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 21 - 211
Target Start/End: Complemental strand, 10516074 - 10515883
Alignment:
| Q |
21 |
aacctgattgtatgaatgcttgttttgattgattggagagaatttagattagtgatagtttgtgatatgttcttgatgtgatcat-aatgagaaatatag |
119 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10516074 |
aacctgattgcatgaatgcttgttttgattgattggagagaatttagattagtgatagttagtgatatgttcttgatgtgatcattaatgagaaatatag |
10515975 |
T |
|
| Q |
120 |
agaaagtaagatattgaacaagtgtatgaaatttagggatgtttaaatatgagttgtaaatcattgtgtatctatgtcaacaatgatacttg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10515974 |
agaaagtaagatattgaacaagtgtatgaaatttaggggtgtttaaatatgagttgtaaatcattgtgtatctatgtcaacaatgatacttg |
10515883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University