View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2317_high_16 (Length: 239)
Name: NF2317_high_16
Description: NF2317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2317_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 3 - 221
Target Start/End: Original strand, 35108443 - 35108648
Alignment:
| Q |
3 |
gagttttcaaggatgagatttttagttttatagttgtttggataaagattcatgcaattattaattcttct--tattgttcacaatctttattaagctct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | |||||||||||||||| |||||||| |
|
|
| T |
35108443 |
gagttttcaaggatgagatttttagttttatagttgtttggataaagattcat----ttattaattcttcttcttttgttcacaatctttagtaagctct |
35108538 |
T |
 |
| Q |
101 |
cactaagtcattgtgactcgtcnnnnnnnnnnnnnnnnagattcacaagttgtagtagtgtataggaatcttttggtgttttcatatatagccaaaagtt |
200 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| || ||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
35108539 |
cactaagtcattgtgacacgtcttttattttattttttagattcacaa-----------gtgtaggaatcttttggtattttcatatgtagccaaaagtt |
35108627 |
T |
 |
| Q |
201 |
tattctttatggtaggtcctt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
35108628 |
tattctttatggtaggtcctt |
35108648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University