View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2317_low_21 (Length: 227)
Name: NF2317_low_21
Description: NF2317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2317_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 7 - 117
Target Start/End: Complemental strand, 44974608 - 44974498
Alignment:
| Q |
7 |
ggctgctctaagtttcatcacaacaaataagagaaatggaaactaaaaacaagtcattcatggaaattatcagaaaagataagagtttgatgaatgtgag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44974608 |
ggctgctctaagtttcatcacaacaaataagagaaatggaaactaaaaacaagtcattcatggaaattatcagaaaagataagagtttgatgaatgtgag |
44974509 |
T |
 |
| Q |
107 |
gtggaaactcc |
117 |
Q |
| |
|
||||||||||| |
|
|
| T |
44974508 |
gtggaaactcc |
44974498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 185 - 227
Target Start/End: Complemental strand, 44974430 - 44974388
Alignment:
| Q |
185 |
aaaatacttaatttcatctgccattttgatttaccaatttttt |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44974430 |
aaaatacttaatttcatctgccattttgatttaccaatttttt |
44974388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University