View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2320_high_3 (Length: 261)
Name: NF2320_high_3
Description: NF2320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2320_high_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 18 - 121
Target Start/End: Complemental strand, 44409421 - 44409318
Alignment:
| Q |
18 |
caataccccccatgatgcatttgggaacacatatggtccttcttcaaagtttccatttttcaataaattggctgcaccaaacaaataaaaacaattgtca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
44409421 |
caataccccccatgatgcatttgggaacacatatggtccttcttcaaagtttccatttttcaataaattggctacaccaaacaaacaaaaacaattgtca |
44409322 |
T |
|
| Q |
118 |
aact |
121 |
Q |
| |
|
|||| |
|
|
| T |
44409321 |
aact |
44409318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 156 - 248
Target Start/End: Complemental strand, 44409318 - 44409226
Alignment:
| Q |
156 |
tagtttaattaagaattttatttgtatgtnnnnnnngcataaaattgatttacagaaatattcaatcatattggaccgtttaattaattacct |
248 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44409318 |
tagtttaattaagaattttatttctatgtaaaaaaagcataaaatagatttacaaaaatattcaatcatattggaccgtttaattaattacct |
44409226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University