View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2320_low_1 (Length: 383)
Name: NF2320_low_1
Description: NF2320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2320_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 10 - 365
Target Start/End: Complemental strand, 53625185 - 53624837
Alignment:
| Q |
10 |
aagaatatgtcatttttatgccgcctcggaagtatactttcatcttccagacaaaatcatagnnnnnnngttttatctaaatgtatactttcggacacac |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
53625185 |
aagaaaatgtcatttttatgccgcctcggaagtatactttcatcttccagacaaaatcatagtttttttgttttatctaaatgtatacttctggacacac |
53625086 |
T |
|
| Q |
110 |
tgggcggaaaaaacctctcatgactcatgactcatgagggaatcataactccgagtagatagatttgcagtactatatttagtgagttttattttccaaa |
209 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
53625085 |
tgggcggaaaaaagctctcatgactcatga-------gggaatcataactccgagtagatagatttgtagtactatatttagtgagttttattttccaaa |
53624993 |
T |
|
| Q |
210 |
cctgaccgcgaggatgtccatttttcttactccatgtatgatggggttggtatgcacccattgctatctcggtatctcttgatccagccaaagatcgttg |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53624992 |
cctgaccgcgaggatgtccatttttcttactccatgtatgatggggttggtatgcacccattgctatctcggtatctcttgatccagccaaagatcgttg |
53624893 |
T |
|
| Q |
310 |
gttgatattggcagacccaaccatcgcatattcatcgtccacaaccattcccttgg |
365 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53624892 |
gttgatattggcagacccaaccatcgcatattcatcgtccacaaccattcccttgg |
53624837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University