View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2320_low_2 (Length: 334)
Name: NF2320_low_2
Description: NF2320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2320_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 6e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 158 - 322
Target Start/End: Original strand, 35820117 - 35820281
Alignment:
| Q |
158 |
tgaaaacatccaatgtcagattaaaaatacatttaacccatatgttttttctgctaagtttttattttgatattgattatacataaaatttggctgtttc |
257 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35820117 |
tgaaaagatccaatgtcggattaaaaatacatttaacccatatgttttttctgctaagtttttattttgatattgattatacataaaatttggctgtttc |
35820216 |
T |
|
| Q |
258 |
ataagggnnnnnnntcaatagaataatttattatgatgtaaataaagttttgatatttagagatg |
322 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35820217 |
ataagggaaaaaaatcaatagaataatttattatgatgtaaataaagttttgatatttagagatg |
35820281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 48139746 - 48139870
Alignment:
| Q |
1 |
tttctttgccctatttcttctcaattgatgatcgaccctgttattttgtccaccggacaggtacttctttttcttattggttatggttattgctctgtat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48139746 |
tttctttgccctatttcttctcaattgatgatcgaccctgttattttgtccaccggacaggtacttctttttcttattggttatggttattgctctgtat |
48139845 |
T |
|
| Q |
101 |
tttattatcttctccacaagttgtc |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
48139846 |
tttattatcttctccacaagttgtc |
48139870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University