View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2320_low_4 (Length: 261)

Name: NF2320_low_4
Description: NF2320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2320_low_4
NF2320_low_4
[»] chr2 (2 HSPs)
chr2 (18-121)||(44409318-44409421)
chr2 (156-248)||(44409226-44409318)


Alignment Details
Target: chr2 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 18 - 121
Target Start/End: Complemental strand, 44409421 - 44409318
Alignment:
18 caataccccccatgatgcatttgggaacacatatggtccttcttcaaagtttccatttttcaataaattggctgcaccaaacaaataaaaacaattgtca 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||    
44409421 caataccccccatgatgcatttgggaacacatatggtccttcttcaaagtttccatttttcaataaattggctacaccaaacaaacaaaaacaattgtca 44409322  T
118 aact 121  Q
    ||||    
44409321 aact 44409318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 156 - 248
Target Start/End: Complemental strand, 44409318 - 44409226
Alignment:
156 tagtttaattaagaattttatttgtatgtnnnnnnngcataaaattgatttacagaaatattcaatcatattggaccgtttaattaattacct 248  Q
    ||||||||||||||||||||||| |||||       ||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||    
44409318 tagtttaattaagaattttatttctatgtaaaaaaagcataaaatagatttacaaaaatattcaatcatattggaccgtttaattaattacct 44409226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University