View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2321_low_1 (Length: 325)
Name: NF2321_low_1
Description: NF2321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2321_low_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 1 - 316
Target Start/End: Complemental strand, 12167708 - 12167393
Alignment:
| Q |
1 |
catcaccctttgagtttctcttctgttcttgaagacaatagaggaggaacaaacatgaatatgtttggtgatccattattctcaactttaagagatccat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12167708 |
catcaccctttgagtttctcttctgttcttgaagacaatagaggaggaacaaacatgaatatgtttggtgatccattattctcaactttaagagatccat |
12167609 |
T |
|
| Q |
101 |
ttttacaagaacttgatcatataccttcttcttcttacttcaacatcacaagtactactagtactacttcacctgcttctataattgatgttgcttcttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12167608 |
ttttacaagaacttgatcatataccttcttcttcttacttcaacatcacaagtactactagtactacttcacctgcttctataattgatgttgcttcttc |
12167509 |
T |
|
| Q |
201 |
tggtgttaatgttactacttcatcatcttcttctgcttctgtttttgcacttgatgagttgagatcaatatcaagaccatgtaaaaacatattctcaaat |
300 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12167508 |
tggtgttagtgttactacttcatcatcttcttctgcttctgtttttgcacttgatgagttgagatcaatatcaagaccatgtaaaaacatattctcaaat |
12167409 |
T |
|
| Q |
301 |
atgattcatatctctc |
316 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
12167408 |
atgattcagatctctc |
12167393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University