View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2323_low_13 (Length: 269)
Name: NF2323_low_13
Description: NF2323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2323_low_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 10 - 252
Target Start/End: Complemental strand, 24993352 - 24993114
Alignment:
| Q |
10 |
gcacagagagagccaaaaacctgtgaccgaattttcatcgatatcatcttgttcatatttgagccgctccaacacattatttaacaataataaatcagtt |
109 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24993352 |
gcacagagagagccaaaaaccagtgaccgaattttcatcgatatcatctcgttcatattttagccgctccaacacattatttaacaatattaaatcagtt |
24993253 |
T |
|
| Q |
110 |
tactgcacatgctagcattttgcagatgccatacttgttgtaaatttgcagctttagttttgtattcaaaagctatatagataaatatacacacacattc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
24993252 |
tactgcacatgctagcattttgcagatgccatacttgttgtaaatttgcagctttagttttgtattcaaaagctatatatctaaatata----cacattc |
24993157 |
T |
|
| Q |
210 |
atctacacacaaacctttaagagtgctgatttacaccgttgat |
252 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24993156 |
atctacacacaaacctttacgagtgctgatttacaccgttgat |
24993114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 202 - 246
Target Start/End: Complemental strand, 1618173 - 1618129
Alignment:
| Q |
202 |
acacattcatctacacacaaacctttaagagtgctgatttacacc |
246 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
1618173 |
acacattcatctaagcacaaacctttaagagtgctggtttacacc |
1618129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University