View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2323_low_17 (Length: 248)
Name: NF2323_low_17
Description: NF2323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2323_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 17 - 235
Target Start/End: Complemental strand, 39680668 - 39680450
Alignment:
| Q |
17 |
atggtaaatagatatagctaaagttagtaaatctaaagcattacaacaaatcaaagtcgtgacaggggatactaatactatagtatagttaattaactgc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39680668 |
atggtaaatagatatagctaaagttagtaaatctaaagcattacaacaaatcaaagtcgtgacaggggatactaatactatagtatagttaattaactgc |
39680569 |
T |
 |
| Q |
117 |
attgaacattctatttagtcttgcgatggatattgatatctaaagtcccaaatagatttttcttcctcctgaccatgtagattatgctcttgattttgag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39680568 |
attgaacattctatttagtcttgcgatggatattgatatctaaagtcccaaatagatttttcttcctcctgaccatgtagattatgctcttgattttgag |
39680469 |
T |
 |
| Q |
217 |
taaaatccatgttgttatt |
235 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
39680468 |
taaaatccatgttgttatt |
39680450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University