View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2323_low_19 (Length: 240)
Name: NF2323_low_19
Description: NF2323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2323_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 19 - 226
Target Start/End: Original strand, 36690801 - 36691008
Alignment:
| Q |
19 |
tgttccccatctacattctgatttgtaccagagaaaatagcattattttgaagaaaagttagnnnnnnnnnnnnnnnncattaatttgaggggatatgtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
36690801 |
tgttccccatctacattctgatttgtaccagagaaaatagcattattttgaagaaaagttagttttttattttattttctttaatttgaggggatatgtt |
36690900 |
T |
 |
| Q |
119 |
tcagaaatggttttgaatctttcaatatttttcagttcaaaatttaatggacctttatggcaaccttctgctgctctcaagttatagatcttttgtgtta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36690901 |
tcagaaatggttttgaatctttcaatatttttcagttcaaaatttaatggacctttatggcaaccttctgctgctctcaagttatagatcttttgtgtta |
36691000 |
T |
 |
| Q |
219 |
atattcag |
226 |
Q |
| |
|
|||||||| |
|
|
| T |
36691001 |
atattcag |
36691008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University