View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2324_high_16 (Length: 527)
Name: NF2324_high_16
Description: NF2324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2324_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 257 - 509
Target Start/End: Original strand, 27672447 - 27672699
Alignment:
| Q |
257 |
ggtttacctttttcacatcacacaagccttcataaacctctaaatatccatctattaggctcttgtttttagaaacataatctgcattgaagtaacttat |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27672447 |
ggtttacctttttcacatcacacaagccttcataaacctctaaatatccatctattaggctcttgtttttagaaacataatctgcattgaagtaacttat |
27672546 |
T |
 |
| Q |
357 |
ttcactactacgaagcacaaaatttacaatacacaaggagaaagcaattcatagtaggtttgacagaatctcaacgagtcatccggttttgcaaaagtca |
456 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| ||||||||||||| |
|
|
| T |
27672547 |
ttcactactaccaagtacaaaatttacaatacacaaggagaaagcaattcatagtaggtttgacagaatcacgacgagtcatccggatttgcaaaagtca |
27672646 |
T |
 |
| Q |
457 |
atggctcgccgtaattctgtcaaacgtcacaatgatatcaaacatgcacatag |
509 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27672647 |
atggctcaccgtaattttgtcaaacgtcacaatgatatcaaacatgcacatag |
27672699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 123; E-Value: 6e-63
Query Start/End: Original strand, 58 - 180
Target Start/End: Original strand, 27672249 - 27672371
Alignment:
| Q |
58 |
ttttctgaaatacaatctccacataccctaccactaaagccaaagcatcctggttttttgcttctctaacaagaatgtttttaatggacttccctgttat |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27672249 |
ttttctgaaatacaatctccacataccctaccactaaagccaaagcatcctggttttttgcttctctaacaagaatgtttttaatggacttccctgttat |
27672348 |
T |
 |
| Q |
158 |
gatttgactagaaagaccaacct |
180 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
27672349 |
gatttgactagaaagaccaacct |
27672371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University