View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2324_high_17 (Length: 522)
Name: NF2324_high_17
Description: NF2324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2324_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 9e-59; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 9e-59
Query Start/End: Original strand, 383 - 502
Target Start/End: Complemental strand, 29126990 - 29126871
Alignment:
| Q |
383 |
tctctgtttgtaacgagaaaagttcaaaaataagaattcagaattatttgggaatggaacgtgtggtagttggaagttagttgtgttgggggaacaaaaa |
482 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29126990 |
tctctgtttgtaacgagaaaagttcaaaaataagaattcagaattatttgggaatggaacgtgtggtagttggaagttagttgtgttggggggacaaaaa |
29126891 |
T |
 |
| Q |
483 |
ttccaccgaatatagttctt |
502 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
29126890 |
ttccaccgaatatagttctt |
29126871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 15 - 119
Target Start/End: Complemental strand, 29127358 - 29127254
Alignment:
| Q |
15 |
gatgaaggtgagaatgatggagaatttcggcatagtttcttggcgaagaagcgagctacggaggctcgctgtgtgaattgaaggaatcagtgaaggaaag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29127358 |
gatgaaggtgagaatgatggagaatttcggcatagtttcttggcgaagaagcgagctacggaggctcgctgtgtgaattgaaggaatcagtgaaggaaag |
29127259 |
T |
 |
| Q |
115 |
tttcg |
119 |
Q |
| |
|
||||| |
|
|
| T |
29127258 |
tttcg |
29127254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 182 - 281
Target Start/End: Complemental strand, 29127191 - 29127092
Alignment:
| Q |
182 |
ccctaattgacgaatttgggggttttgatgaaaaagagggagaaagaaagagaaagaatcttcgttgccgttggttttggttgtaaaaggagaatgtgtc |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29127191 |
ccctaattgacgaatttgggggttttgatgaaaaagagggagaaagaaagagaaagaatcttcgttgccgttggttttggttgtaaaaggagaatgtgtc |
29127092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University