View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2324_high_39 (Length: 390)
Name: NF2324_high_39
Description: NF2324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2324_high_39 |
 | |
|
| [»] chr5 (6 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 270; Significance: 1e-151; HSPs: 6)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 18 - 390
Target Start/End: Complemental strand, 39118368 - 39117997
Alignment:
| Q |
18 |
tatacgatctgcaactttttctcattctatggtattatttatctatgtaatgtttatttgttttgttagttcaaagatttttcacaatagataagcaagt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39118368 |
tatacgatctgcaactttttctcattctatggtattatttatctatgtgatgtttatttgttttgttagttcaaagatttttcacaatagataagcaagt |
39118269 |
T |
|
| Q |
118 |
gtgaattttggtagtgctaaaagagtggtgaagcctgtgagctagcannnnnnnnnnactagctatggtcagcagtagcgtttggcaagcttttgcaggt |
217 |
Q |
| |
|
|| ||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39118268 |
gttaattttggtagtgctaatagagtggtgaagcctgtgagctagca-tttttttttactagctatggtctgcagtagcgtttggcaagcttttgcaggt |
39118170 |
T |
|
| Q |
218 |
gctttccggacacttatgtttgtctagatgaccttaacttcacaaaaagaaagtccccgggttcgaaacgcgatgttggtctgcctacgctttatgagcn |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| ||||| |||||||||||||| |
|
|
| T |
39118169 |
gctttccggacacttatgtttgtctagatgaccttaacttcacaaaaagaaagtcctcgggttcgaatcgcgatgttgatctgcatacgctttatgagct |
39118070 |
T |
|
| Q |
318 |
nnnnnnnaggatttggtggacttcctctcggtttgatagttcttggtacaggacctgcagattatggagttgg |
390 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39118069 |
tttttttaggatttgtaggacttcctctcggtctgatagttcttggtacaggacctgcagattatggagttgg |
39117997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 193 - 271
Target Start/End: Original strand, 38611136 - 38611214
Alignment:
| Q |
193 |
tagcgtttggcaagcttttgcaggtgctttccggacacttatgtttgtctagatgaccttaacttcacaaaaagaaagt |
271 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||| |||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
38611136 |
tagcgtttggcaagcttttgcaggtgatttgcggacactgatgtttgtctagatcaccttaacctcacaaaaagaaagt |
38611214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 208 - 284
Target Start/End: Original strand, 38612286 - 38612362
Alignment:
| Q |
208 |
ttttgcaggtgctttccggacacttatgtttgtctagatgaccttaacttcacaaaaagaaagtccccgggttcgaa |
284 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| ||||||| |||||||||| |
|
|
| T |
38612286 |
ttttgcaggtgctttctggacacttatgtttgtctagatgaccttaacttcccaaaacgaaagtcatcgggttcgaa |
38612362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 325 - 390
Target Start/End: Complemental strand, 39120276 - 39120211
Alignment:
| Q |
325 |
aggatttggtggacttcctctcggtttgatagttcttggtacaggacctgcagattatggagttgg |
390 |
Q |
| |
|
|||||||| ||||||||||| ||| ||||| |||||||| |||||||||| |||||||||||||| |
|
|
| T |
39120276 |
aggatttgtaggacttcctcttggtctgataattcttggttcaggacctgctgattatggagttgg |
39120211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 325 - 390
Target Start/End: Original strand, 38611298 - 38611363
Alignment:
| Q |
325 |
aggatttggtggacttcctctcggtttgatagttcttggtacaggacctgcagattatggagttgg |
390 |
Q |
| |
|
|||||||| |||||||||||||| |||||||| |||| |||||||||| |||||||||||||| |
|
|
| T |
38611298 |
aggatttgcaggacttcctctcggcctgatagttaatggtccaggacctgctgattatggagttgg |
38611363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 244 - 272
Target Start/End: Complemental strand, 39120386 - 39120358
Alignment:
| Q |
244 |
gatgaccttaacttcacaaaaagaaagtc |
272 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39120386 |
gatgaccttaacttcacaaaaagaaagtc |
39120358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University