View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2324_high_60 (Length: 309)
Name: NF2324_high_60
Description: NF2324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2324_high_60 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 18 - 295
Target Start/End: Original strand, 25136082 - 25136359
Alignment:
| Q |
18 |
aacttgcggagaaccgatccgggttgaagaaattcgagtaataatcttaaaagagtcatcatcccttgtgtaacctaacaatgatcatagcagaggtaca |
117 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25136082 |
aacttgcgaagaaccgatccgggttgaagaaatttgagtaataatcttaaaagagtcatcatcccttgtataacctaacaatgatcatagcagaggtaca |
25136181 |
T |
|
| Q |
118 |
tagtcaataatgcatgactattaagtgggaacatggcctcccgtcaatcggtaattatttattaatgttgaattgtattaaggcagagaagatttcccta |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25136182 |
cagtcaataatgcatgactattaagtgggaacatggcctcccgtcaatcggtaattatttattaatgttgaattgtattaaggcagagaagatttcccta |
25136281 |
T |
|
| Q |
218 |
gtcaaatgccaatggtttagaaaatgagtatactataaaatgtcatggttccatctgaagccatccatcatatacagt |
295 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25136282 |
gtcaaatgccagtggtttagaaaatgagtatactataaaatgtcatggttccatctgaagccatccatcatatacagt |
25136359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University